How to use the dna base composition calculator
Count A, T, G and C bases in a sequence. Enter dna sequence in the field above; the adenine (a), thymine (t), guanine (g), cytosine (c) are computed instantly and plotted on the chart so you can see how the answer changes.
Formula
Variables
- seq — DNA sequence
Worked example
With dna sequence = ATGCGTACGTTAGCATTAGC, the calculator gives adenine (a) ≈ 5; thymine (t) ≈ 6; guanine (g) ≈ 5; cytosine (c) ≈ 4.
Frequently asked questions
What is the formula for the dna base composition calculation?
Adenine (A) = cnt(seq,"A"). Thymine (T) = cnt(seq,"T"). Guanine (G) = cnt(seq,"G"). Cytosine (C) = cnt(seq,"C"). Here seq is dna sequence.
What inputs do I need for the dna base composition calculator?
You need dna sequence. Each field is pre-filled with a typical example so you can see how the result responds as you edit the numbers.
How do I use this calculator?
Type values into the input fields. Results and the chart update instantly. Use Reset to restore the example values, Copy results to paste them elsewhere, or Share to copy a link that preserves your inputs.
Is the result exact?
Calculations use standard formulas and double-precision arithmetic, then display about seven significant figures. Real-world measurements carry uncertainty, so treat results as estimates unless your inputs are exact.